Plattform für Wasser, Gas und Wärme
Fachartikel
12. Januar 2022

Fallbeispiel Fadenbakterien

DNA-Analyse im Belebtschlamm

Das Einwachsen des Fadenbakteriums «Candidatus Microthrix» ist mittels DNA-Analyse bereits ersichtlich, noch bevor der Schlammvolumenindex massgeblich zunimmt. Am Fallbeispiel der ARA Richterswil konnte dies deutlich aufgezeigt werden. Die DNA-Analyse kann somit zur Früherkennung von Trends im Belebtschlamm eingesetzt werden. Da die gesamte mikrobielle Gemeinschaft analysiert wird, ist die DNA-Analyse auch für die Detektion und Nachverfolgung von Schlüssel-Mikroorganismen wie Nitrifikanten, Denitrifikanten, phosphorakkumulierenden Bakterien sowie Anammox interessant.
Alexandra  Fumasoli, Nina Gubser, Andreas Keller David Weissbrodt, 

Die Analyse von Erbgut (DNA) hat sich in den letzten Jahren zu einer zuverlässigen und kostengünstigen Methode entwickelt, die in der Abwasserforschung bereits standardmässig eingesetzt wird [1, 2]. Die DNA-Analyse erlaubt einen Einblick in die mikrobielle Zusammensetzung des Belebtschlamms. In Kombination mit den Betriebsparametern ermöglicht sie ein vertieftes Verständnis der biologischen Vorgänge.

Da durch die DNA-Analyse die gesamte mikrobielle Gemeinschaft des Belebtschlamms analysiert wird, eignet sich diese Methode für verschiedene Fragestellungen [3]. Eine Anwendungsmöglichkeit ist die Detektion von Fadenbakterien. Dies machte man sich auf der ARA Richterswil zunutze: Um das Auftreten des schlecht absetzbaren Schlamms und des hohen Schlammvolumenindexes (SVI) besser zu verstehen, wurden regelmässig Biomasseproben mittels DNA-Analysen untersucht.

Als Resultat der DNA-Analyse erhält man die Namen und die relative Häufigkeit aller Populationen in der Belebtschlammprobe. Die Namen können mit Datenbanken von Referenzsequenzen, wie der MiDAS-Datenbank [4], abgeglichen werden, wo Bakterien im Belebtschlamm und in der Faulung klassifiziert wurden. In dieser aus globalen Belebt- und Faulschlammproben erstellten Datenbank sind auch erste Proben von Schweizer Kläranlagen eingeflossen.

Das Ziel dieser Studie war, die DNA-Analyse anhand des Fallbeispiels der ARA Richterswil zu testen, die Möglichkeiten der DNA-Analyse mit anderen mikrobiellen Methoden zu vergleichen und Anwendungsbereiche für die DNA-Analyse aufzuzeigen.

Vorgehen
Layout ARA Richterswil

Die ARA Richterswil wird heute zweistrassig betrieben. Die Strasse 1 wird mit rund 33% des Abwassers beschickt und besteht aus zwei in Serie geschalteten Belebungsbecken mit je 190 m3 (Fig. 1). Die Strasse 2 wird mit rund 66% des Abwassers beschickt und besteht aus zwei parallelen 500-m3-Becken.

Die Strasse 1 wird ganzjährig ohne Denitrifikation betrieben. Die Strasse 2 verfügt über eine bivalente Zone mit einem Volumenanteil von 18%, die bei sehr kalten Temperaturen belüftet wird. Die Strasse 2 wurde vom 25. Februar 2020 bis zum 7. Januar 2021 mit Denitrifikation betrieben.

Der SVI und die Konzentration des Belebtschlamms in der Biologie werden täglich gemessen. Die Frachten im Zulauf zur Biologie und die Ablaufkonzentrationen erfolgen als 24-h-Sammelproben alle fünf Tage.

Probenahme und Analysemethode

Auf der ARA Richterswil wurde zwischen dem 10. März 2020 und dem 15. Februar 2021 wöchentlich eine Belebtschlammprobe aus Strasse 1 und Strasse 2 gemäss dem Probenahmeprotokoll der mit der Analyse beauftragten Firma DNAsense, Alborg, Dänemark, entnommen. Dabei wurde ein Probevolumen von rund einem Liter Belebtschlamm während aktiver Belüftung aus den Biologiestrassen abgeschöpft. Die Probe wurde in einer Probeflasche geschüttelt, bevor die jeweils 1,8 ml der Probe ins Probenahmegefäss pipettiert wurden. Die Biomasseproben wurden dann bei –20 °C eingefroren.

Basierend auf dem Verlauf des SVI wurden 17 Proben für die Analyse ausgewählt. Die Proben wurden so gewählt, dass ein stetiger Anstieg des SVI nachvollzogen werden kann.

Die ausgewählten Proben wurden gekühlt für eine 16S rRNA-Gen-Amplikon-Sequenzierung an DNAsense geschickt. Dort wurde die DNA extrahiert, der Bereich der 16S rRNA des Schlammes (Amplikon) wurde durch Polymerase-Kettenreaktion (Polymerase Chain Reaction, PCR) vervielfältigt und die PCR-Produkte mit einem MiSeq Desktop Sequenzer (Illumina, USA) analysiert. Für die PCR wurden die 16S V1-3 spezifischen Primer-Paare: [27F] AGAGTTTGATCCTGGCTCAG und [534R] ATTACCGCGGCTGCTGG verwendet [5].

Die bakterielle Zuordnung und relativen Häufigkeiten erfolgten aus den Sequenzierungsdatensätzen aufgrund der MiDAS-Datenbank v. 3.6 [4] und aufgrund von bioinformatischen und biostatistischen Workflows wie ampvis2 [6] bei DNAsense.

Fallbeispiel ARA Richterswil
Analyse der Bakterienpopulation

Unter den 30 häufigsten Gattungen in den analysierten Proben wurde systematisch nach Gattungen gesucht, die zusammen mit einem hohen SVI vorkommen. Dabei fällt auf, dass das verbreitete Fadenbakterium «Candidatus Microthrix» (im folgenden Ca. Microthrix) mit einer relativen Häufigkeit von bis zu 10% vorkommt (Fig. 2) und unter allen Gattungen am besten mit dem SVI korreliert (Korrelationskoeffizient = 0,76). Lichtmikroskopische Untersuchungen zeigten einen der Morphologie von Ca. Microthrix ähnlichen Belebtschlamm. Eine eindeutige Bestimmung mittels Gram-Färbung wurde jedoch nicht durchgeführt. Nebst Ca. Microthrix wurden weitere unbekannte Taxa in den Familien Microthricaceae und Nocardiaceae detektiert. Diese wiesen aber alle eine deutlich geringere Korrelation mit dem SVI auf.

In Bezug auf die Nitrifikanten ist ersichtlich, dass bei den ammoniumoxidierenden Bakterien (AOB) nur die Gattung Nitrosomonas detektiert wurde (Fig. 2). Die nitritoxidierenden Bakterien (NOB) gehörten nicht zu den 30 häufigsten Gattungen, weshalb sie nicht in Figur 2 ersichtlich sind. Es sind aber NOB der Gattung Nitrospira vorhanden. Während einer Phase im Dezember 2020 mit Nitrifikationsproblemen wuchs kurzzeitig der NOB Nitrotoga ein.

Eine vertiefte Analyse der Populationszusammensetzung mit einer Principal-Component-Analyse (PCA) ist in Figur 3 aufgezeigt. Je weiter bei einer PCA die Datenpunkte auseinander liegen, desto unterschiedlicher ist die bakterielle Zusammensetzung. Die Analyse zeigt, dass sich die Population in Strasse 2 zwischen Juni und August 2020 stark verändert (Shift von Bereich A nach Bereich B in Fig. 3). Zwischen November und Dezember 2020 gibt es einen Shift zurück (von Bereich B zu Bereich A), sodass sich die Population wieder ähnlich zusammensetzt wie im Frühling 2020. Auch in Strasse 1 ist ein Shift über die Zeit ersichtlich; dieser ist aber weniger schnell als in Strasse 2. Unklar ist, ob die zeitgleiche Veränderung des SVI zu diesem Populationsshift beitrug oder ob andere Parameter (z. B. Temperatur) diesen bewirkt haben.

Verlauf von Ca. Microthrix

Die logarithmische Darstellung in Figur 4 zeigt, dass die relative Häufigkeit von Ca. Microthrix ab Anfang Oktober 2020 in Strasse 2 exponentiell zunimmt. In dieser Phase verzeichnen wir erst einen leichten Anstieg im SVI. Das Einwachsen ist also mittels DNA-Analyse zu einem sehr frühen Zeitpunkt detektierbar.

Das exponentielle Wachstum von Ca. Microthrix erfolgt in Strasse 1 erst rund einen Monat später als in Strasse 2. Nebst dem späteren Einwachsen weist Strasse 1 über den gesamten Zeitraum einen geringeren SVI auf als Strasse 2. Dies könnte im Zusammenhang mit der Denitrifikationsstufe stehen: Ca.-Microthrix-Populationen setzen sich häufig in Systemen mit alternierenden Bedingungen (aerob, anaerob, anoxisch) durch, während aerobe Bedingungen mit Sauerstoffkonzentrationen > 2 mg/l hinderlich für das Wachstum von Ca. Microthrix sind [7]. Dies bestätigt sich auch in der MiDAS-Datenbank [4]: Bei den vier nur nitrifizierenden Schweizer Kläranlagen wurde Ca. Microthrix nicht beobachtet. In den neun Kläranlagen mit Denitrifikation ist hingegen Ca. Microthrix das am häufigsten detektierte Fadenbakterium.

Um den SVI zu verbessern, wurde Ende Dezember 2020 während zehn Tagen ein Fällmittel auf Aluminiumbasis dosiert. Neuste Studien zeigen, dass eine Aluminiumzugabe möglicherweise nur bei Ca. Microthrix subdominans und nicht bei Ca. Microthrix parvicella effektiv ist [1]. Um welche Ca.-Microthrix-Art es sich auf der ARA Richterswil handelt (subdominans oder parvicella), wurde nicht analysiert. Die DNA-Daten in Strasse 2 zeigen jedoch eine Reduktion von Ca. Microthrix und eine kurzzeitige Verbesserung des SVI. Allerdings ist Ca. Microthrix auch nach Beendigung der Aluminiumzugabe immer noch häufig und wächst schnell wieder ein.
In Strasse 1 zeigt sich keine offensichtliche Wirkung der Aluminiumzugabe. Die relative Häufigkeit von Ca. Microthrix nimmt im Gegenteil stark zu. Aufgrund des Peaks im SVI könnte Ca. Microthrix in dieser Zeit auch stark aus Strasse 2 über die Vorklärung in Strasse 1 eingeschwemmt worden sein.

Bekämpfungsstrategien

Auf der ARA Richterswil werden deutliche Unterschiede im SVI und im Verhalten von Ca. Microthrix in den beiden Strassen festgestellt, obwohl die Strassen mit dem gleichen Abwasser beschickt werden. Grundsätzlich ist somit Potenzial für Optimierungsstrategien vorhanden. Häufig stehen diese aber in Konkurrenz zu anderen Zielwerten. Dies zeigt sich insbesondere bei der Belüftung: Eine konstante Belüftung hindert das Wachstum von Ca. Microthrix, steht aber in Konkurrenz zur Denitrifikation.

Zielführender ist eine Anpassung bei der Überschussschlamm-Eindickung: Mit einer maschinellen Eindickung können Ca. Microthrix effektiver aus der Biologie entfernt werden als durch die Absetzung in der Vorklärung. Als Option könnte der Überschussschlamm auch geflockt werden, um die Absetzeigenschaften zu verbessern und die Entfernung der Ca. Microthrix in der Vorklärung sicher­zustellen.

Denkbar wäre auch, den Überschussschlamm nur aus der Strasse 2 mit dem schlechten SVI abzuziehen und die Strasse 2 mit dem Überschussschlamm von Strasse 1 anzuimpfen. Allerdings ist auch die Realisierung dieser Massnahme auf der ARA Richterswil aufwendig.

Schliesslich bietet sich eine Dosierung von Fällmitteln auf Aluminiumbasis zur Symptombekämpfung an. Die Dosierung müsste aber über einen längeren Zeitraum oder zu einem früheren Zeitpunkt erfolgen. Fällmittel auf Aluminiumbasis könnten so zum Beispiel während der Wintermonate dosiert werden. Es sollte aber darauf geachtet werden, dass nicht nur Aluminium, sondern auch Eisen dosiert wird, um eine H2S-Bildung in der Faulung zu vermeiden. Die Dosierung von Aluminium führt zudem zu Mehrkosten bei der Fällmittelbeschaffung und – aufgrund des schlechteren Entwässerungsgrads – bei der Schlammentsorgung.

Als Alternative könnte Ca. Microthrix mit DNA-Proben konstant überwacht werden. Dadurch könnte Aluminium nur bedarfsweise dosiert werden und Betriebskosten könnten eingespart werden. Die unmittelbare Analyse von einzelnen DNA-Analysen in der Schweiz wird heute noch nicht angeboten, wäre aber grundsätzlich möglich.

DNA-Analysen im Vergleich

Die Analyse von DNA durch Amplikon-Sequenzierung ist eine von mehr als 30 Analysemethoden, um Mikroorganismen (und ihre Metabolismen) nachzuweisen [8]. Für die einfache praktische Umsetzung auf Kläranlagen stehen für die Detektion von Mikroorganismen zurzeit vier Methoden im Fokus:

  • Lichtmikroskopie
  • DNA-Analyse mittels Amplikon-Sequenzierung
  • quantitative PCR (qPCR) und
  • Fluoreszenz-in-situ-Hybridisierung (FISH) (Fig. 5)


Die Analysemethode richtet sich nach der Untersuchungsfrage.

Lichtmikroskopie

Die visuelle Beurteilung von Biomasse mit der Lichtmikroskopie ist ein wichtiger erster Analyseschritt und gibt einen Überblick über das generelle Erscheinungsbild der Biomasse. So kann beispielsweise festgestellt werden, ob der Schlamm eine flockige oder filamentöse Form aufweist oder ob er vorwiegend aus Prokaryoten (Bakterien) oder Eukaryoten (z. B. Protozoen, Mikroalgen) besteht. In den 1980er-Jahren wurden umfassende Identifizierungstabellen für Fadenbakterien erstellt und für die Prozesssteuerung vorgeschlagen [9]. Mit lichtmikroskopischen Methoden können auch granulierter Schlamm oder Biofilmträger untersucht werden. Basierend auf der visuellen Inspektion kann eine nächste Reihe von Analysen ausgewählt werden, um die mikrobielle Zusammensetzung und die Mikroorganismen zu identifizieren.

DNA-Analyse mittels Amplikon-Sequenzierung

Die DNA-Analyse mittels Amplikon-Sequenzierung liefert einen detaillierten Gesamtüberblick über die mikrobielle Gemeinschaft. Als Resultat erhält man dabei die Namen und die relative Häufigkeit aller Populationen in der Belebtschlammprobe (Fig. 2), wodurch einerseits Trends von Schlüssel-Organismen (z. B. Fadenbakterien), andererseits Shifts in der gesamten Population festgestellt werden (z. B. mittels PCA, Fig. 3). DNA-Analysen geben nicht die metabolische Funktionalität der Organismen wieder, aber durch die Namen der Populationen ergeben sich Hinweise zum metabolischen Potenzial der Biomasse. Die Hinweise ergeben sich aufgrund von Vorkenntnissen und Datenbanken wie MiDAS, die Gensequenzen und Funktionalitäten von Mikroorganismen inventarisieren [4].

Quantitative PCR (qPCR)

qPCR ist eine weitere Methode, um bestimmte mikrobielle Populationen, wie Fadenbakterien, Mikroorganismen der Stickstoff- und Phosphorkreisläufe sowie Antibiotikaresistenzen zu detektieren. Aufgrund der tiefen Nachweisgrenze eignet sich qPCR vor allem auch zur Detektion bei sehr tiefen Konzentrationen. Obwohl die Methode als «quantitativ» bezeichnet wird, sind qPCR-Ergebnisse von Labor zu Labor kaum reproduzierbar und sollten nicht als absolute Quantifizierung betrachtet werden [10].

Fluoreszenz-in-situ-Hybridisierung (FISH)

FISH in Kombination mit Epifluores­zenzmikroskopie (EFM) oder fortge­schrittenerer konfokaler Laser-Scanning-Mikroskopie (CLSM) bietet den Vorteil, dass spezifische Mikroorganismen im Schlamm visuell lokalisiert werden. Die Methode eignet sich auch zur Semi-Quantifizierung von Mikroorganismen [11].

Da sowohl bei qPCR als auch bei FISH spezifische Populationen untersucht werden, ist eine vorgängige DNA-Analyse wertvoll, sodass die richtigen Populationen untersucht werden. Typischerweise eignen sich deshalb die Analyseschritte gemäss Figur 5:

  • Mikroskopie, um das generelle Erscheinungsbild und die Flockenstruktur zu analysieren.
  • DNA-Analysen, um die mikrobielle Zusammensetzung zu erhalten.
  • Die Sensitivität beim Nachweis bestimmter Populationen kann durch qPCR erhöht werden.
  • FISH hilft, gezielte Population visuell zu lokalisieren und zu semi-quantifizieren.
Weitere Anwendungsbeispiele

Mit dem technologischen Fortschritt wird das Durchführen von mikrobiellen Analysen auf Abwasserreinigungsanlagen immer attraktiver. Gerade bei Fragestellungen, bei denen man mit den herkömmlichen Analysemethoden an Grenzen stösst, kann das Prozessverständnis durch eine Ergänzung mit DNA-Analysen erhöht werden. Dies wird besonders interessant, wenn die Analyseresultate direkt vor Ort verfügbar sind, wie dies die neue Nanopore-Sequenzierungs-Technologie verspricht [3, 12]. Mit dem Forschungsprojekt Microcensus der Eawag soll ein portables Analyse-Kit auf Schweizer Kläranlagen entwickelt und getestet werden.
Nebst der Detektion von Fadenbakterien (Fig. 2 und 4) liefert die DNA-Analyse wertvolle Zusatzinformationen zu weiteren Schlüssel-Mikroorganismen im Belebtschlamm. Im Zusammenhang mit der Nitrifikation sind vor allem die AOB und die NOB von Interesse. Gemäss der MiDAS-Datenbank [4] ist auf Seiten AOB mehrheitlich die Gattung Nitrosomonas typisch für Schweizer Kläranlagen, während bei den NOB sowohl Nitrospira als auch Nitrotoga auftreten. Auf der ARA Richterswil wie auch auf der ARA Uster wurde beobachtet, dass unter normalen Bedingungen vor allem Nitrospira präsent war, während in Zeiten mit unvollständiger Nitrifikation mit entsprechend hohen Nitritfrachten Nitrotoga eingewachsen ist [2]. Im Rahmen des Forschungsprojektes Nitripop der Eawag werden die Gründe für saisonale Nitritakkumulation untersucht.
Bei den Denitrifikanten sind die Kenntnisse noch limitiert. Mit der Weiterentwicklung der MiDAS-Datenbank [4] werden zukünftig aber auch Denitrifikanten detektierbar.

Im Zusammenhang mit der biologischen Phosphorelimination sind polyphosphat-akkumulierende Organismen (PAO) wie Ca. Accumulibacter phosphatis und Tetrasphaera wünschenswert, während das Vorkommen von glykogen-akkumulierenden Organismen (GAO) Ca. Competibacter phosphatis und Defluviicoccus problematisch ist. Die GAO können ebenfalls unter anaeroben Bedingungen Kohlenstoffverbindungen speichern, leider aber, ohne dabei Phosphor zu eliminieren.

Für einen stabilen Anammox-Prozess sind die AOB und die Anammox-Bakterien essenziell, während NOB unerwünscht sind. Insbesondere, wenn die Prozesse alle in einem Reaktor erfolgen, kann die Aktivität der einzelnen Mikroorganismen nicht quantifiziert werden, sondern nur die gesamte Umsatzrate. Auf der ARA Odense in Dänemark wurde deshalb der Prozess mit regelmässigen DNA-Analysen der AOB, NOB und Anammox-Bakterien überwacht (Demon process, VandCenter Syd, Odense, Dänemark). Dabei konnte ein Verlust von Anammox-Bakterien detektiert werden, was eine rechtzeitige Bekämpfungsstrategie ermöglichte. Gerade bei diesem sensiblen Prozess mit langsam wachsenden Anammox-Bakterien ist es wichtig, negative Veränderungen frühzeitig zu erkennen, um langanhaltende Betriebsprobleme vorzubeugen.
Auch in weiteren biologischen Stufen, wie der anaeroben Schlammfaulung, gibt es erste Anwendungsbeispiele aus der Praxis. Mit dem Fortschreiten von DNA-Analysen auf Schweizer Kläranlagen erhöht sich die Vergleichbarkeit und die Aussagekraft der Analyseresultate.

Fazit und Ausblick

Das Einwachsen von Ca. Microthrix ist mittels DNA-Analysen ersichtlich, bevor der SVI massgeblich zunimmt. DNA-Analysen können somit zur Früherkennung eingesetzt werden. Dies würde eine bedarfsgerechte Dosierung von Aluminium-Fällmitteln zur Symptombekämpfung erlauben. Ebenfalls kann anhand von DNA-Analysen die Wirksamkeit einer Aluminiumzugabe überprüft werden. Eine unmittelbare Analyse von einzelnen DNA-Proben in der Schweiz wird heute noch nicht angeboten, wäre aber grundsätzlich möglich.

Die konventionelle Mikroskopie erlaubt einen ersten visuellen Überblick über die Flockenstruktur. Als Ergänzung dazu ermöglicht die DNA-Analyse, Trends und relative Häufigkeiten aller Populationen im Belebtschlamm zu analysieren. Zukünftig soll dies auch direkt vor Ort möglich sein. Von offensichtlichem Interesse sind bei der DNA-Analyse die Schlüssel-Mikroorganismen wie Nitrifikanten, Denitrifikanten, phosphorakkumulierende Bakterien und Anammox. Daneben gibt es aber auch viele Bakterien, über deren Funktionen im Belebtschlamm noch wenig bekannt ist. Je mehr Datensätze aus der Schweiz und weltweit vorhanden sind, desto besser wird unser Verständnis der Bakterien und ihrer Funktionen sein und desto eher können daraus Massnahmen zur Prozesskontrolle der ARA abgeleitet werden.

Bibliographie

[1] Nierychlo, M. et al. (2021): Low global diversity of Candidatus Microthrix, a troublesome filamentous organism in full-scale WWTPs. Frontiers in Microbiology 12: 690251
[2] Gruber, W. et al. (2021): Linking seasonal N2O emissions and nitrification failures to microbial dynamics in a SBR wastewater treatment plant, Water Research, 11: 100098
[3] Cerruti, M. et al. (2021): Plant-wide systems microbiology for the wastewater industry. Environmental Science: Water Research and Technology 7: 1687–1706
[4] McIlroy, S.J. et al. (2017): MiDAS 2.0: An ecosystem-specific taxonomy and online database for the organisms of wastewater treatment systems expanded for anaerobic digester groups. Database 2017(1), bax016
[5] Ward, D.V. et al. (2012): Evaluation of 16s rDNA-based community profiling for human microbiome research. PLoS ONE 7: e39315
[6] Andersen, K.S. et al. (2018): ampvis2: an R package to analyse and visualise 16S rRNA amplicon data. bioRxiv 299537
[7] Rossetti, S. et al. (2005): «Microthrix parvicella», a filamentous bacterium causing bulking and foaming in activated sludge systems: a review of current knowledge. FEMS Microbiology Reviews 29(1): 49–64
[8] Weissbrodt, D.G. et al. (2020): Chapter 2. Basic Microbiology and Metabolism. In: Chen, G.H.; van Loosdrecht, M.C.M.; Ekama, G.A.; Brdjanovic, D.; eds. Biological Wastewater Treatment: Principles, Modeling and Design. 2nd Edition, IWA Publishing, London, UK
[9] Eikelboom, D.H. (2000): Process Control of Activated Sludge Plants by Microscopic Investigation, IWA Publishing, London, UK
[10] Agrawal, S. et al. (2020): Time to act – assessing variations in qPCR analyses in biological nitrogen removal with examples from partial nitritation/anammox systems. Water Research, 190: 116604
[11] Nielsen, P.; Daims, H. (2009): FISH Handbook for Biological Wastewater Treatment, IWA Publishing, London, UK
[12] Brandt, C.; Bongcam-Rudloff, E.; Müller, B. (2020): Abundance Tracking by Long-Read Nanopore Sequencing of Complex Microbial Communities in Samples from 20 Different Biogas/Wastewater Plants, Applied Sciences, 10(21): 7518

Kommentar erfassen

Kommentare (0)

e-Paper

«AQUA & GAS» gibt es auch als E-Paper. Abonnenten, SVGW- und/oder VSA-Mitglieder haben Zugang zu allen bisher erschienen Ausgaben von A&G.

Den «Wasserspiegel» gibt es auch als E-Paper. Im SVGW-Shop sind sämtliche bisher erschienen Ausgaben frei zugänglich.

Die «gazette» gibt es auch als E-Paper. Sämtliche bisher erschienen Ausgaben sind frei zugänglich.